Church of the Flying Spaghetti Monster

From GodWiki
Jump to navigation Jump to search
Church of the Flying Spaghetti Monster
FSM_Logo.svg.png
Motto: We've got beer in the afterlife.
Alignment: Humane
Leader: GodCursed One 
Founder(s):
Date Founded: Apr. 29, 2013 (1085 g.e.)
Forum Headquarters: Church of the Flying Spaghetti Monster
Guild Page: Church of the Flying Spaghetti Monster 
Data current as of May 16, 2018 (2928 g.e.)


The Church of the Flying Spaghetti Monster is a guild dedicated to letting people think for themselves about how to conform with official church doctrine. Join us for fun and probably very little profit. Although we are not evil by nature many perceive us that way based on narrow mindlessness.

About the Church

Please read all about our faith at Venganza.org.

Favored Weapon

Extemporaneous transcendental solipsistic deconstructive metaethics.

Joining

To join, you may give the voice command below:

«
Join "Church of the Flying Spaghetti Monster" guild!
»

Your Hero/ine must be at least level 12, and must be on the road and not in a town, as well as idle, not fighting a monster. Once your Hero/ine listens, it will appear in a new line in his/her Diary. Also, you can see that the quest has begun under Hero tab. It sometimes takes several attempts to get the Hero/ine to listen, so patience is advised.

And to be perfectly clear, it's probably the best decision you'll ever make. You don't want to be associated with some lame nerf herders guild, do you?

Staying

If you Hero/ine is manipulated into beginning a quest to join some lesser guild not devoted to His Noodly Goodness (prior to reaching Grand Master rank), give the voice command below:

«
Hey stupid, stop the quest to leave the "Church of the Flying Spaghetti Monster" guild!!
»

Alternatively, "Stop quest" will also work.

Median Sequence for Gene KIAA0319 on Chromosome 6p22.3

GGATTCATACCCATGGCATT

Ranks

Rank First Day Last Day Note
Fan 0 1
Intern 1 3
Recruit 3 8 Can post to chat
Follower 8 18
Master 18 35
Chief Master 35 60 Duels contribute to Guild rank
Advisor 60 90
Grand Master 90 135 Won't randomly leave Guild
Cardinal 135 200 Can vote for leader; contributes to Guild earning a Totem
Hierarch 200 300 Can run for leader
P/Matriarch 300 450
Regent 450 600
Prophet 600 800
Pastafarian 800

Contributing

He boiled for our sins. We sinned for fun.

Add all Church members as friends to promote a friendly cult environment.

Encourage, punish or miracle while in town, including to get bricks. The reason to do it in town is that your hero/ine may increase our guild’s influence there (increasing the chance for all of us to get free loot and bragging rights). Simultaneously, you increase the chance of getting loot for your “active promotion of the guild” when you visit a town again.

Note that Godville is the least useful town in which to try to build influence, because the influence there is fleeting (every hero goes there every day, and they all work to negate your influence).

Official Citrus Fruit

Lime flavored llamas, of course.

Distinguished Members

Current:
Dark Lord - founder, past leader (thrice) and pastafarian
Nonsensesynapse - past leader and pastafarian
Sarlemon - past leader and pastafarian
Purveyor of toads - past leader and pastafarian
Selkie - past leader and pastafarian
Top Cat - pastafarian
Almighty Zorg - pastafarian
Mversion - pastafarian
Doccid - pastafarian
MAAAGNO - pastafarian
Auryx - past leader
Iris Marsters - pastafarian
Bill Hedge - pastafarian
Roguetech - pastafarian
Corran Horn - past leader and pastafarian
Novok - pastafarian
Cursed One - past leader


Past:
Arakan - past leader and past pastafarian

Allied Guilds

No one. We drink our own beer!

See also

Flying Spaghetti Monster (monster)

External links